Basic Infomation

Event NK603
OECD UI MON-ØØ6Ø3-6
Trade Name Roundup Ready Maize
Species Zea mays (Maize)
Introduced Trait Herbicide Tolerant
Transformation Method Microparticle bombardment
Transformation Vector PV-ZMGT32
Developer Monsanto Company

Primer Infomation

        [See Related Multiplex PCR]
qualitative:  
hsp70 and cp4 epsps      444 bp
Mon810 1-5: GAGTTTCCTTTTTGTTGCTCTC
NK603 1-3: GCTGCTTGCACCGTGAAG

Submitter
Administrator
Shanghai Jiao Tong University, China
E-mail: zhangdb@sjtu.edu.cn
Reference+Add New Reference
    1. Matsuoka T., Kuribara H., Akiyama H., Miura H., Goda Y., Kusakabe Y., Isshiki K., Toyoda M., Hino A. A multiplex PCR method of detecting recombinant DNAs from five lines of genetically modified maize. J. Food Hyg. Soc. Jpn. 2001, 42, 24-32    
    2. Mari Onishi, Takeshi Matsuoka, Takashi Kodama, Koichi Kashiwaba, Satoshi Futo, Hiroshi Akiyama, Tamio Maitani, Satoshi Furui, Taichi Oguchi, Akihiro Hino. Development of a multiplex polymerase chain reaction method for simultaneous detection of eight events of genetically modified maize. J. Agric. Food Chem. 2005, 53(25), 9713-9721    
Comment+Add Comments