Basic Infomation

Event NK603
OECD UI MON-ØØ6Ø3-6
Trade Name Roundup Ready Maize
Species Zea mays (Maize)
Introduced Trait Herbicide Tolerant
Transformation Method Microparticle bombardment
Transformation Vector PV-ZMGT32
Developer Monsanto Company

Primer Infomation

        [See Related Multiplex PCR]
qualitative:  
ctp2/EPSPS      108 bp
F: ATGAATGACCTCGAGTAAGCTTGTTAA
R: BIOTIN-AAGAGATAACAGGATCCACTCAAACACT
Capture P: ALD-AAAAAAAAAAAAAAAAAAAAAAGGGATATCAAGCTTGGTACCACGCGACACACTTCCACTCT

Submitter
admin
Shanghai Jiao Tong University, China
E-mail: zhangdb@sjtu.edu.cn
Reference+Add New Reference
    1. SULAN BAI,†, ) JIE ZHANG,‡, ) SHUCHENG LI,†, ) HAODONG CHEN,#, ) WILLIAM TERZAGHI,^ XIN ZHANG,† XIURONG CHI,‡ JIN TIAN,‡ HONGXIA LUO,‡ WENSHENG HUANG,§ YING CHEN,*,§ AND YAOCHUAN ZHANG*,‡. Detection of Six Genetically Modified Maize Lines Using Optical Thin-Film Biosensor Chips. J. Sci. Food Agric. 2010, 58, 8490-8494    
Comment+Add Comments