Basic Infomation

Event NK603
OECD UI MON-ØØ6Ø3-6
Trade Name Roundup Ready Maize
Species Zea mays (Maize)
Introduced Trait Herbicide Tolerant
Transformation Method Microparticle bombardment
Transformation Vector PV-ZMGT32
Developer Monsanto Company

Primer Infomation

        [See Related Multiplex PCR]
qualitative:  
hsp70 and CTP2      143 bp
NK603 01-5: TATCTTGCTCGATGCCTTCTCC
NK603 01-3: ACACCATTGCAGATTCTGCTAACT

Submitter
TFmao
Shanghai Jiao Tong University, China
E-mail: zhangdb@sjtu.edu.cn
Reference+Add New Reference
    1. Amendment to The Food Standard & Specifications, KFDA's Notification No.2007-68    
Comment+Add Comments