Basic Infomation

Event NK603
OECD UI MON-ØØ6Ø3-6
Trade Name Roundup Ready Maize
Species Zea mays (Maize)
Introduced Trait Herbicide Tolerant
Transformation Method Microparticle bombardment
Transformation Vector PV-ZMGT32
Developer Monsanto Company

Primer Infomation

        [See Related Multiplex PCR]
quantitative:  TaqMan
      113 bp
Nk603mzpF: CGGCCAGCAAGCCTTGTA
Nk603mzpR: TCCCGACTCTCTTCTCAAGCA
Nk603p: FAM-CCGCGTTAACAAGCTTACTCGAGGTCATTC-TAMRA

Submitter
Administrator
Shanghai Jiao Tong University, China
E-mail: zhangdb@sjtu.edu.cn
Reference+Add New Reference
    1. Hsin-Ying Huang, Tzu-Ming Pan. Detection of genetically modified maize MON810 and NK603 by multiplex and real-time polymerase chain reaction methods. J. Agric. Food Chem. 2004, 52(11), 3264-3268    
Comment+Add Comments