Basic Infomation

Event NK603
OECD UI MON-ØØ6Ø3-6
Trade Name Roundup Ready Maize
Species Zea mays (Maize)
Introduced Trait Herbicide Tolerant
Transformation Method Microparticle bombardment
Transformation Vector PV-ZMGT32
Developer Monsanto Company

Primer Infomation

        [See Related Multiplex PCR]
quantitative:  TaqMan
      0 bp
88_17-L: CTGCTCGGCCAGCAAGCCT
88_17-R: AAGCATATGAATGACCTCGAGTA
88_17-P: FAM-TAGCGGCCCACGCGTGGTAC-TAMRA

Submitter
Administrator
Shanghai Jiao Tong University, China
E-mail: zhangdb@sjtu.edu.cn
Reference+Add New Reference
Comment+Add Comments