Basic Infomation

Event NK603
OECD UI MON-ØØ6Ø3-6
Trade Name Roundup Ready Maize
Species Zea mays (Maize)
Introduced Trait Herbicide Tolerant
Transformation Method Microparticle bombardment
Transformation Vector PV-ZMGT32
Developer Monsanto Company

Primer Infomation

        [See Related Multiplex PCR]
quantitative:  TaqMan
3 end junction      108 bp
NK603 primer F: ATGAATGACCTCGAGTAAGCTTGTTAA
NK603 primer R: AAGAGATAACAGGATCCACTCAAACACT
NK603 probe PR: FAM-TGGTACCACGCGACACACTTCCACTC-TAMRA

Validation

Item 0.1 0.49 0.98 1.96 4.91
Laboratories having returned results 12 12 12 12 12
Samples per laboratory 2 2 2 2 2
Laboratories excluded 3 0 0 1 1
Reason 2C & 1G 0 0 1C 1C
Mean value 0.183 0.847 1.436 2.235 5.994
Repeatability relative standard deviation (%) 24.249 15.239 17.163 7.694 21.629
Repeatability standard deviation 0.044 0.129 0.247 0.172 1.296
Reproducibility relative standard deviation (%) 37.075 34.450 25.425 26.055 31.041
Reproducibility standard deviation 0.068 0.292 0.365 0.582 1.861
Bias (absolute value) 0.083 0.357 0.456 0.275 1.084
Bias (%) 83.00 72.86 46.50 14.03 22.08

Validated PCR Program

PCR Program
Temperature Time Cycle
Activation 95°C 600s
Amplification 95°C 15s 45
- -
60°C 60s
Final - -

Submitter
Administrator
Shanghai Jiao Tong University, China
E-mail: zhangdb@sjtu.edu.cn
Reference+Add New Reference
    1. A recommended procedure for real-time quantitative TaqMan PCR for Roundup Ready Corn NK603    
    2. Event-specific method for the quantitation of maize line NK603 using real-time PCR Validation Report, EU-CRL, 2004    
Comment+Add Comments