Basic Infomation

Event MON89034
OECD UI MON-89Ø34-3
Trade Name
Species Zea mays (Maize)
Introduced Trait Insect Resistant
Transformation Method Agrobacterium tumefaciens-mediated plant transformation
Transformation Vector
Developer Monsanto Company

Primer Infomation

        [See Related Multiplex PCR]
quantitative:  TaqMan
the 3’ insert-to-plant junction      77 bp
MON 89034 primer 1: TTCTCCATATTGACCATCATACTCATT
MON 89034 primer 2: CGGTATCTATAATACCGTGGTTTTTAAA
MON 89034 (Probe): -FAM–ATCCCCGGAAATTATGTT–MGBNFQ

Submitter
admin
Shanghai Jiao Tong University, China
E-mail: zhangdb@sjtu.edu.cn
Reference+Add New Reference
    1. Event-specific Method for the Quantification of Maize Line MON 89034 Using Real-time PCR     
Comment+Add Comments