Basic Infomation

Event NK603
OECD UI MON-ØØ6Ø3-6
Trade Name Roundup Ready Maize
Species Zea mays (Maize)
Introduced Trait Herbicide Tolerant
Transformation Method Microparticle bombardment
Transformation Vector PV-ZMGT32
Developer Monsanto Company

Primer Infomation

        [See Related Multiplex PCR]
qualitative:  
tNOS/maize genome      108 bp
NK603-1F: ATGAATGACCTCGAGTAAGCTTGTTAA
NK603-2R: AAGAGATAACAGGATCCACTCAAACACT

Submitter
admin
Shanghai Jiao Tong University, China
E-mail: zhangdb@sjtu.edu.cn
Reference+Add New Reference
    1. XIANG LI. Simplex and Duplex Polymerase Chain Reaction Analysis of Herculex ® RW(59122) Maize Based on One Reference Molecule Including Separated Fragments of 5 Integration Site and Endogenous Gene. J. AOAC Int. 2009, 10, -    
    2. KAILIN SHEN1. Establishment and In-House Validation of Simplex and Duplex PCR Methods for Event-Specific Detection of Maize SYN-E3272-5 Using a New Reference Molecule. J. AOAC Int. 2010, 93, -    
    3. Detection of genetically modified plants and derived products ——Qualitative PCR method for herbicide-tolerant maize NK603 and its derivates. Announcement by the Ministry of Agriculture No.869-13-2007 . . 2007, , -    
Comment+Add Comments