Basic Infomation

Event NK603
OECD UI MON-ØØ6Ø3-6
Trade Name Roundup Ready Maize
Species Zea mays (Maize)
Introduced Trait Herbicide Tolerant
Transformation Method Microparticle bombardment
Transformation Vector PV-ZMGT32
Developer Monsanto Company

Primer Infomation

        [See Related Multiplex PCR]
chip:  
5’ flanking region      120 bp
NK603-AF: TCGGCCAGCAAGCCTTGTAG
NK603-AR: GGACTATCCCGACTCTCTTC
NK603: TGACCTCGAGTAAGCTTGTTAACGCGGCCG

Submitter
admin
Shanghai Jiao Tong University, China
E-mail: zhangdb@sjtu.edu.cn
Reference+Add New Reference
    1. JAE -HWAN KIM , SU -YOUN KIM , HYUNGJAE LEE , YOUNG -ROK KIM , AND HAE -YEONG KIM . An Event-Specific DNA Microarray To Identify Genetically Modified Organisms in Processed Foods. J. Agric. Food Chem. 2010, 58, 6018-6026    
Comment+Add Comments