Basic Infomation

Event MON 87460
OECD UI MON-8746Ø-4
Trade Name
Species Zea mays (Maize)
Introduced Trait
Transformation Method Agrobacterium tumefaciens-mediated transformation
Transformation Vector
Developer Monsanto Company

Primer Infomation

        [See Related Multiplex PCR]
quantitative:  TaqMan
5’ insert-to-plant junction      82 bp
MON 87460 forward: CACGTTGAAGGAAAATGGATTG
MON 87460 reverse: TCGCGATCCTCCTCAAAGAC
MON 87460 probe: -FAM–AGGGAGTATGTAGATAAATTTTCAAAGCGTTAGACGGC–TAMRA

Submitter
admin
Shanghai Jiao Tong University, China
E-mail: zhangdb@sjtu.edu.cn
Reference+Add New Reference
    1. C. Savini et al.. Event-specific Method for the Quantification of Maize MON 87460 Using Real-time PCR. European Union Reference Laboratory for GM Food and Feed (EURL-GMFF) 2012, , -    
Comment+Add Comments