Basic Infomation

Event MON89034
OECD UI MON-89Ø34-3
Trade Name
Species Zea mays (Maize)
Introduced Trait Insect Resistant
Transformation Method Agrobacterium tumefaciens-mediated plant transformation
Transformation Vector
Developer Monsanto Company

Primer Infomation

        [See Related Multiplex PCR]
qualitative:  
flanking sequence      207 bp
89034-F: GCTGCTACTACTATCAAGCCAATA
89034-R: TGCTTTCGCCTATAAATACGAC

Submitter
admin
Shanghai Jiao Tong University, China
E-mail: zhangdb@sjtu.edu.cn
Reference+Add New Reference
    1. Detection of genetically modified plants and derived products-Qualitative PCR method for insert-resistant maize line MON89034 and its derivates. Announcement by the Ministry of Agriculture No.1861-4-2012. . 2012, , -    
Comment+Add Comments