Basic Infomation

Event RF3
OECD UI ACS-BNØØ3-6
Trade Name InVigor Canola
Species Brassica napus (Argentine Canola)
Introduced Trait Herbicide Tolerant, Fertility Restoration
Transformation Method
Transformation Vector pTHW118
Developer Bayer CropScience (Aventis CropScience(AgrEvo))

Primer Infomation

        [See Related Multiplex PCR]
qualitative:  
flanking sequence      284 bp
RF3-F: CAATAACTTTGTTGGGCTTATGG
RF3-R: CTCGTCTCGGACCTCCGAAAACC

Submitter
admin
Shanghai Jiao Tong University, China
E-mail: zhangdb@sjtu.edu.cn
Reference+Add New Reference
    1. Detection of genetically modified plants and derived products Qualitative PCR method for herbicide-tolerant rapeseed MS1,RF1 and their derivates. Announcement by the Ministry of Agriculture No.869-4-2007. . 2007, , -    
Comment+Add Comments