Basic Infomation

Event NK603
OECD UI MON-ØØ6Ø3-6
Trade Name Roundup Ready Maize
Species Zea mays (Maize)
Introduced Trait Herbicide Tolerant
Transformation Method Microparticle bombardment
Transformation Vector PV-ZMGT32
Developer Monsanto Company

Primer Infomation

        [See Related Multiplex PCR]
qualitative:  
5'flanking sequence      120 bp
NK603-AF: TCGGCCAGCAAGCCTTGTAG
NK603-AR: GGACTATCCCGACTCTCTTC

Submitter
admin
Shanghai Jiao Tong University, China
E-mail: zhangdb@sjtu.edu.cn
Reference+Add New Reference
    1. Jae-Hwan Kim, Dabing Zhang, Hae-Yeong Kim. Detection of sixteen genetically modified maize events in processed foods using four event-specific pentaplex PCR systems. Food Control 2014, 35, 345-353    
Comment+Add Comments