Basic Infomation

Event MON89034
OECD UI MON-89Ø34-3
Trade Name
Species Zea mays (Maize)
Introduced Trait Insect Resistant
Transformation Method Agrobacterium tumefaciens-mediated plant transformation
Transformation Vector
Developer Monsanto Company

Primer Infomation

        [See Related Multiplex PCR]
qualitative:  
5'flanking sequence      120 bp
M89034-CF: AACCCATGCACGGCCATTCA
M89034-CR: GACCATCATACTCATTGCTG

Submitter
admin
Shanghai Jiao Tong University, China
E-mail: zhangdb@sjtu.edu.cn
Reference+Add New Reference
    1. Jae-Hwan Kim, Dabing Zhang, Hae-Yeong Kim. Detection of sixteen genetically modified maize events in processed foods using four event-specific pentaplex PCR systems. Food Control 2014, 35, 345-353    
Comment+Add Comments