Basic Infomation

Event NK603
OECD UI MON-ØØ6Ø3-6
Trade Name Roundup Ready Maize
Species Zea mays (Maize)
Introduced Trait Herbicide Tolerant
Transformation Method Microparticle bombardment
Transformation Vector PV-ZMGT32
Developer Monsanto Company

Primer Infomation

        [See Related Multiplex PCR]
qualitative:  
3'-junction      221 bp
NK603L11-5': CCGCTACCAGCACCTTTTAC
NK603L11-3': CCTCGAGTATTGGCTTGGAG

Submitter
admin
Shanghai Jiao Tong University, China
E-mail: zhangdb@sjtu.edu.cn
Reference+Add New Reference
    1. Kong-Sik Shin, Seok-Cheol Suh, Myung-Ho Lim, Hee-Jong Woo, Jin Hyoung Lee, Hae-Yeong Kim, and Hyun-Suk Cho. Event-Specific Detection System ofStacked Genetically Modified Maize by using the Multiplex-PCR Technique. Food Sci. Biotechnol. 2013, 22, 1763-1772    
Comment+Add Comments