Basic Infomation

Event RF3
OECD UI ACS-BNØØ3-6
Trade Name InVigor Canola
Species Brassica napus (Argentine Canola)
Introduced Trait Herbicide Tolerant, Fertility Restoration
Transformation Method
Transformation Vector pTHW118
Developer Bayer CropScience (Aventis CropScience(AgrEvo))

Primer Infomation

        [See Related Multiplex PCR]
quantitative:  TaqMan
      0 bp
Rf3-RB3: GGAATTAACATCTACAAATTGCCTTT
Rf3-RB8: TTGTAATTAGAAACCCTGAAATTTGT
TQ-Rf3RB: FAM-TCGCGAGATGAAAAAGGCATTTACC-TAMRA

Submitter
whitepig
Shanghai Jiao Tong University, China
E-mail: whitepigstewart@163.com
Reference+Add New Reference
Comment+Add Comments