Basic Infomation

Event RF3
OECD UI ACS-BNØØ3-6
Trade Name InVigor Canola
Species Brassica napus (Argentine Canola)
Introduced Trait Herbicide Tolerant, Fertility Restoration
Transformation Method
Transformation Vector pTHW118
Developer Bayer CropScience (Aventis CropScience(AgrEvo))

Primer Infomation

        [See Related Multiplex PCR]
quantitative:  TaqMan
      0 bp
KVM084: AGCATTTAGCATGTACCATCAGACA
DPA165: CATAAAGGAAGATGGAGACTTGAG
TM010: FAM-CGCACGCTTATCGACCATAAGCCCA-TAMRA

Validation

Unknown sample GM% 0.1 0.4 0.9 1.8 3.6
Laboratories having returned results 13 13 13 13 13
Samples per laboratory 4 4 4 4 4
Laboratories excluded 1 1 0 2 2
Reason 1G 1C - 2C 1C & 1G
Mean value 0.11 0.42 0.94 1.76 3.41
Repeatability relative standard deviation (%) 13 12 14 12 13
Repeatability standard deviation 0.01 0.05 0.13 0.20 0.46
Reproducibility relative standard deviation (%) 13 15 23 13 19
Reproducibility standard deviation 0.01 0.06 0.21 0.23 0.66
Bias (absolute value) 0.007 0.017 0.041 -0.044 -0.186
Bias (%) 6.9 4.4 4.5 -2.5 -5.2

Validated PCR Program

PCR Program
Temperature Time Cycle
Activation 95°C 600s
Amplification 95°C 15s 45
- -
60°C 60s
Final - -

Submitter
TFmao
Shanghai Jiao Tong University, China
E-mail: zhangdb@sjtu.edu.cn
Reference+Add New Reference
    1. Event-specific Method for the Quantification of Oilseed Rape Line Rf3 Using Real-time PCR Protocol, EU-CRL    
Comment+Add Comments