Primer Infomation

        [See Related Multiplex PCR]
quantitative:  TaqMan
      70 bp
Adh primer F : CCAGCCTCATGGCCAAAG
Adh primer R: CCTTCTTGGCGGCTTATCTG
Adh probe: CTTAGGGGCAGACTCCCGTGTTCCCT

Submitter
admin
Shanghai Jiao Tong University, China
E-mail: zhangdb@sjtu.edu.cn
This Method Have Been Used to Detect:+Add New Event
NK603    
MON863    
GA21    
Reference+Add New Reference
    1. Nina Papazova & David Zhang & Kristina Gruden & Jana Vojvoda & Litao Yang & Meti Buh Gašparič & Andrej Blejec & Stephane Fouilloux & Marc De Loose & Isabel Taverniers. Evaluation of the reliability of maize reference assays for GMO quantification. Anal Bioanal Chem. 2010, 396, 2189-2201    
    2. ANNALISA PATERNO`, UGO MARCHESI, FRANCESCO GATTO, DANIELA VERGINELLI, CINZIA QUARCHIONI, CRISTIANA FUSCO, ALESSIA ZEPPARONI, DEMETRIO AMADDEO, AND ILARIA CIABATTI*. Finding the Joker among the Maize Endogenous Reference Genes for Genetically Modified Organism (GMO) Detection. J. Agric. Food Chem. 2009, , 11086-11091    
Comment+Add Comments