Primer Infomation

        [See Related Multiplex PCR]
qualitative:  
nos 3      151 bp
tNOS 2-5: GTCTTGCGATGATTATCATATAATTTCTG
tNOS 2-3: CGCTATATTTTGTTTTCTATCGCGT

Submitter
Administrator
Shanghai Jiao Tong University, China
E-mail: zhangdb@sjtu.edu.cn
This Method Have Been Used to Detect:+Add New Event
MON863    
MON531, MON757, MON1076    
MON1445, MON1698    
LLCotton25    
MON15985    
BT11 (X4334CBR, X4734CBR)    
GA21    
NK603    
GTS 40-3-2    
MON802    
Reference+Add New Reference
    1. Seong-Hun Lee, Dong-Myung Min, Jin-Kug Kim. Qualitative and quantitative polymerase chain reaction analysis for genetically modified maize MON863. J. Agric. Food Chem. 2006, 54(4), 1124-1129    
    2. Hideo Kuribara, Yoichiro Shindo, Takeshi Matsuoka, Ken Takubo, Satoshi Futo, Nobutaro Aoki, Takashi Hirao, Hiroshi Akiyama, Yukihiro Goda, Masatake Toyada, Akihiro Hino. Novel reference molecules for quantitation of genetically modified maize and soybean. J. AOAC Int. 2002, 85(5), 1077    
    3. Seong-Hun Lee, Jin-Kug Kim, Bu-Young Yi . Detection methods for biotech cotton MON15985 and MON 88913 by PCR. J. Agric. Food Chem. 2007, , -    
    4. Takeshi Matsuoka, Hideo Kuribara, Ken Takubo, Hiroshi Akiyama, Hirohito Miura, Yukihiro Goda, Yuko Kusakabe, Kenji Isshiki, Masatake Toyoda, Akihiro Hino. Detection of recombinant DNA segments introduced to genetically modified maize (Zea mays). J. Agric. Food Chem. 2002, 50(7), 2100-2109    
Comment+Add Comments