Primer Infomation

        [See Related Multiplex PCR]
quantitative:  TaqMan
nos 3      84 bp
180-F: CATGTAATGCATGACGTTATTTATG
180-R: TTGTTTTCTATCGCGTATTAAATGT
Tm-180: ATGGGTTTTTATGATTAGAGTCCCGCAA

Submitter
grohmann
Federal Office of Consumer Protection and Food Safety, Germany
E-mail: lutz.grohmann@bvl.bund.de
This Method Have Been Used to Detect:+Add New Event
GTS 40-3-2    
BT11 (X4334CBR, X4734CBR)    
NK603    
GA21    
MON809    
MON863    
CBH-351    
MIR604    
55-1, 63-1    
MS1 x RF1    
MS8 x RF3    
OXY-235    
GM Shanyou 63    
Reference+Add New Reference
    1. R. Reiting, H. Broll, H.-U. Waiblinger, L. Grohmann. Collaborative Study of a T-nos Real-Time PCR Method for Screening of Genetically Modified Organisms in Food Products. J. Verbr. Lebensm. 2007, 2, 116-121    
    2. Huber I, Block A, Sebah D, Debode F, Morisset D, Grohmann L, Berben G, Stebih D, Milavec M, Zel J, Busch U.. Development and Validation of Duplex, Triplex, and Pentaplex RealTime PCR Screening Assays for the Detection of Genetically Modified Organisms in Food and Feed. J. Agric. Food Chem. 2013, 61, 10293-10301    
Comment+Add Comments